Compile Data Set for Download or QSAR
Found 11 of ic50 for UniProtKB: P42225
LigandPNGBDBM549118(BDBM50556884 | US11299480, Example 53)copy SMILES
Affinity DataIC50: 1.46E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549075(BDBM50556877 | US11299480, Example 34)copy SMILES
Affinity DataIC50: 2.61E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549125(BDBM50556925 | US11299480, Example 135)copy SMILES
Affinity DataIC50: 3.14E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549132(BDBM50556940 | US11299480, Example 138)copy SMILES
Affinity DataIC50: 4.71E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM50556895(CHEMBL4760561)copy SMILES
Affinity DataIC50: 4.92E+3nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract pre...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549075(BDBM50556877 | US11299480, Example 34)copy SMILES
Affinity DataIC50: 1.20E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549132(BDBM50556940 | US11299480, Example 138)copy SMILES
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549118(BDBM50556884 | US11299480, Example 53)copy SMILES
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM50556895(CHEMBL4760561)copy SMILES
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM549125(BDBM50556925 | US11299480, Example 135)copy SMILES
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubate...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2Z89H31PubMed
LigandPNGBDBM20283(2-hydroxy-4-(2-{[(4-methylbenzene)sulfonyl]oxy}ace...)copy SMILEScopy InChI
Affinity DataIC50: 3.00E+5nMAssay Description:Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction aft...More data for this Ligand-Target Pair
In DepthDetails Article
BindingDB Entry DOI: 10.7270/Q2CJ8FKKPubMed