Target/Host (Institution) | Ligand | Target/Host Links | Ligand Links | Trg + Lig Links | Ki nM | ΔG° kJ/mole | IC50 nM | Kd nM | EC50/IC50 nM | koff s-1 | kon M-1s-1 | pH | Temp °C |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533361 (CHEMBL4451895) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 100 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533382 (CHEMBL4531566) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 150 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468819 (CHEMBL4281296) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 150 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468792 (CHEMBL4280869) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 150 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533405 (CHEMBL4550191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 180 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533385 (CHEMBL4474029) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 190 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468792 (CHEMBL4280869) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 200 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533361 (CHEMBL4451895) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 200 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533382 (CHEMBL4531566) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 200 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533367 (CHEMBL4461191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 220 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468846 (CHEMBL4291913) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 220 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533386 (CHEMBL4466368) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 240 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468792 (CHEMBL4280869) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 250 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533385 (CHEMBL4474029) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 250 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468792 (CHEMBL4280869) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 250 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468819 (CHEMBL4281296) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 250 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468819 (CHEMBL4281296) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 300 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533361 (CHEMBL4451895) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 300 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468819 (CHEMBL4281296) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 300 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533382 (CHEMBL4531566) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 300 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533382 (CHEMBL4531566) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 300 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533377 (CHEMBL4475877) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 310 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533385 (CHEMBL4474029) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 320 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase (Human immunodeficiency virus 1) | BDBM50533385 (CHEMBL4474029) | PDB MMDB UniProtKB/TrEMBL B.MOAD GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 340 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of polymerase activity of HIV1 reverse transcriptase using poly(rA)-oligo(dT)16 and [3H]-TTP incubated for 20 mins by liquid scintillation... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468846 (CHEMBL4291913) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 370 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533405 (CHEMBL4550191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 370 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533376 (CHEMBL4453169) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 380 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533353 (CHEMBL4549947) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533392 (CHEMBL4529253) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533353 (CHEMBL4549947) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533367 (CHEMBL4461191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Integrase (Human immunodeficiency virus 1) | BDBM23399 (4-{1-[(4-fluorophenyl)methyl]-1H-pyrrol-2-yl}-2,4-...) | PDB UniProtKB/TrEMBL B.MOAD GoogleScholar AffyNet | CHEMBL KEGG PC cid PC sid UniChem Patents Similars | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-C... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533361 (CHEMBL4451895) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 400 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533367 (CHEMBL4461191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 430 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533376 (CHEMBL4453169) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 440 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533376 (CHEMBL4453169) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 450 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50468846 (CHEMBL4291913) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 450 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533405 (CHEMBL4550191) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 450 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533386 (CHEMBL4466368) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 460 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533372 (CHEMBL4454510) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 470 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533354 (CHEMBL4455962) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 470 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533386 (CHEMBL4466368) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 490 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533403 (CHEMBL4563882) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 500 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533353 (CHEMBL4549947) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 500 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533359 (CHEMBL4472917) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 500 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533372 (CHEMBL4454510) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 510 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533377 (CHEMBL4475877) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 540 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533406 (CHEMBL4471489) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 600 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533352 (CHEMBL4530415) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 600 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair | |||||||||||||
Reverse transcriptase/RNaseH (Human immunodeficiency virus 1) | BDBM50533354 (CHEMBL4455962) | PDB MMDB UniProtKB/TrEMBL B.MOAD DrugBank GoogleScholar AffyNet | PC cid PC sid UniChem | Article PubMed | n/a | n/a | 600 | n/a | n/a | n/a | n/a | n/a | n/a |
University of Minnesota Curated by ChEMBL | Assay Description Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3... | J Med Chem 59: 2648-59 (2016) Article DOI: 10.1021/acs.jmedchem.5b01879 BindingDB Entry DOI: 10.7270/Q2QN6B8P | |||||||||||
More data for this Ligand-Target Pair |
Displayed 1 to 50 (of 250 total ) | Next | Last >> |